Table 1 DNA oligonucleotide primers used in the present study
OligonucleotidesDNA Sequence 5′–3′
TSP5 coiled coil
690FGATCAAGCTTGGACAGGGCCAGAGC
644RGTACGTTAACTAGGTTACCCAGGGGCCGCACGCTGGGTAGGCC
TSP1C
445FGTACGTTAACATTGATGGATGCCTGTCCAAT
446RGTACCTCGAGTTAGGGATCTCTACATTCGTA
TSP-5-1C
690FGATCAAGCTTGGACAGGGCCAGAGC
446RGTACCTCGAGTTAGGGATCTCTACATTCGTA
FLAG–mRFP–TSP-5-1C
787FGATCGAATTCAATGGCCTCCTCC
779RGTACTCTAGATTAGGGATCTCTACATTCGTATTTCAGG
FLAG–TSP1C
688FGATCAAGCTTATTGGCCACAAGACA
779RGTACTCTAGATTAGGGATCTCTACATTCGTATTTCAGG
FLAG–TSP-5-1C
690FGATCAAGCTTGGACAGGGCCAGAGC
779RGTACTCTAGATTAGGGATCTCTACATTCGTATTTCAGG