Table 1 DNA sequences of substrates used in the experiments
dsDNA 42 bp
GK1425′-GACAGGATCCGGGCTAGCATCTTCATACATAGTTGTCACTGG
GK1435′-CCAGTGACAACTATGTATGAAGATGCTAGCCCGGATCCTGTC
5′-flap substrate, 21 bp duplex dsDNA
GK1455′-ATTGGTTATTTACCGAGCTCGAATTCACTGG
GK1355′-CCAGTGAATTCGAGCTCGGTACCCGCTAGCGGGGATCCTCTA
5′-flap substrate, 21 bp duplex dsDNA blocked by 5′-biotin
GK1455′-ATTGGTTATTTACCGAGCTCGAATTCACTGG
GK1445′-biotin-CCAGTGAATTCGAGCTCGGTACCCGCTAGCGGGGATCCTCTA
5′-flap substrate, 16 bp duplex dsDNA
GK2305′-ATTGGTTATTATTTCAGCTCGAATTCACTGG
GK1355′-CCAGTGAATTCGAGCTCGGTACCCGCTAGCGGGGATCCTCTA
5′-flap substrate, 12 bp duplex dsDNA
GK2295′-ATTGGTTATTATTTTTTTACGAATTCACTGG
GK1355′-CCAGTGAATTCGAGCTCGGTACCCGCTAGCGGGGATCCTCTA
5′-flap substrate, 8 bp duplex dsDNA
GK2285′-ATTGGTTATTATTTTTTTATTTTTTCACTGG
GK1355′-CCAGTGAATTCGAGCTCGGTACCCGCTAGCGGGGATCCTCTA
5′-flap substrate, forked hairpin substrate
GK2325′-TTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGGGT
1–5, 9 and 10 nt overhang, forked hairpin substrate
GK2515′-TGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2525′-TTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2555′-TTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2575′-TTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2535′-TTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2465′-TTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2475′-TTTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
1, 5 and 10 nt overhang, closed nick substrate
GK2575′-TGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGGC
GK2585′-TTTTTGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGGC
GK2595′-TTTTTTTTTTGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGGC
1, 5 and 10 nt overhang, gap substrate
GK2605′-TGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGG
GK2615′-TTTTTGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGG
GK2625′-TTTTTTTTTTGGTACCGAGTTCTCGGTACCGCCGCTAGCTTGCTAGCGG
1, 5 and 10 nt overhang, closed gap substrate
GK2495′-TTTTTTTTTTTTTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2505′-TTTTTTTTTTTTTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCCAGG
GK2545′-TTTTTT(TEG-biotin)TTTTTTTTTTTTTGAGAGGATCCAGCTTTTTTGCTGGATCCTCTCCGCC
Size markers, 10 bp and 12 bp
GK2455′-TTCACCGGTA
GK1965′-AATTCACCGGTA