Table 1 Primers used in the present study
NameSequence (5′ to 3′)
circRNA FACCCACCGATTATCTCTCCTG
circRNA RTCCTATTCCTTCGCTGCTTTC
GAPDH FAGAAGGCTGGGGCTCATTTG
GAPDH RAGGGGCCATCCACAGTCTTC
LASP1 FCCCAGTCTCCATACAGCGCA
LASP1 RCTCCACCGTCCCGTACATCC
U6 FGCTTCGGCAGCACATATACTAAAAT
U6 RCGCTTCACGAATTTGCGTGTCAT
MiR-1294 FCGTGTGAGGTTGGCATTGTTGTCT
MiR-1294 RmRQ 3′ Primer provided by the kit