Table 1 Primer sequences for RT-qPCR analysis
TargetPrimer sequence (5′→3′)
ZnT-1ForwardCCCACTGCTCAAGGAGTCCGCTCT
ReverseTGTAACTCATGGACTTCCTCCACT
MT1ForwardGTACCTTCTCCTCACTTACTCCG
ReverseGTATAGGAAGACGCTGGGTTGG
MT2ForwardATGGACCCCAACTGCTCCTG
ReverseCAGCAGGTGCACTTGTCCGA
CHOPForwardCCACCACACCTGAAAGCAGAA
ReverseAGGTGA AAGGCAGGGACTCA
GADD34ForwardCCTCTA AAAGCTCGGAAGGTACAC
ReverseTCGGACTGTGGA AGAGATGGG
ATF4ForwardGGGTTCTGTCTTCCACTCCA
ReverseAAGCAGCAGAGTCAGGCTTTC
β-ActinForwardCGCATCCTCTTCCTCCCTGG
ReverseCCTAGAAGCACT TGCGGTGCAC