Table 2 DNA oligonucleotide primer 2 sequence of Real-LAMP for the fbs B gene
NamePrimer (55′-35′)Primer length (bp)
Upstream (FIP)CAACTGGTTGAACCGGAGCTCTCCACAACAAAGTTCAACTG41
Downstream (BIP)CAGCACATGATGCCATTTCAGCAGGTCATTTCCGCAGTTG40
Upstream (F3)AGAAATCTGAAACTGTGGCA20
Downstream (B3)TCCCTAAAGCTTTCTCAACATC21
Upstream (LF)CTGTTGGACAGAAGTTTGCG20
Downstream (LB)TTGCTAATACAGCCGGTGTAA21