Table 1 DNA oligonucleotide primer 1 sequence of LAMP for the fbs B gene
NamePrimer (5′-35′)Primer length (bp)
Upstream (FIP)CAACTGGTTGAACCGGAGCTCTCCACAACAAAGTTCAACTG41
Downstream (BIP)GCAGCACATGATGCCATTTCAGAGGTCATTTCCGCAGTTG40
Upstream (F3)AGAAATCTGAAACTGTGGCA20
Downstream (B3)TCCCTAAAGCTTTCTCAACATC22
Upstream (LF)CTGTTGGACAGAAGTTTGCG20
Downstream (LB)TTGCTAATACAGCCGGTGTAA21