Table 1 Amplification primers and PCR amplification product information
GeneSNPPrimer sequencesAnnealing temperature (°C)
IL-17rs763780Forward: ACCCCTGTCATCCACCATGT60
(7488 A/G)Reverse: GTGGCATTTCTACAGCTTCTTCA
rs2275913Forward: CTATGACCTCATTGGGGGCG60
(-197 G/A)Reverse: GGTCACTTACGTGGCGTGTC
rs8193036Forward: CCATCTCCATCACCTTTGTCCA60
(-737 C/T)Reverse: TTCCAACCCTGCATGCTACC
NF-κB1rs3774934Forward:TTTCTGTACACTCCATTGAAACTGT60
(4531 G/A)Reverse: GCAGTGCTTGTAGCATTGTTTCT