Table 1 Sequences of primers used in the present study
Primer nameSequencesProduct sizes (bp)
Plac9-3tag-S1ATGCGGATCCCACCATGCGGCCCCTG261 bp
Plac9-3tag-A1GTACCTCGAGGAAGCCATCTCCGAGAAGG
CSH1-3tag-S1ATGCGGATCCATGGCTACAGGCTCCCGG651 bp
CSH1-3tag-A1GCATCTCGAGGAAGCCACAGCTGCCCTCCA
hTRX-3tag-S1ATCGGGATCCATGGTGAAGCAGATCGAGA315 bp
hTRX-3tag-A1CGCGCTCGAGGACTAATTCATTAATGGTGGC
Plac9-FGGCTGTGCAACGCCGTCTA84 bp
Plac9-RAGCAGGCCTTTCACCTCTGTC
GAPDH-FTGACTTCAACAGCGACACCCA121 bp
GAPDH-RCACCCTGTTGCTGTAGCCAAA